ID: 900174356_900174369

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 900174356 900174369
Species Human (GRCh38) Human (GRCh38)
Location 1:1285264-1285286 1:1285298-1285320
Sequence CCAGGACTCCAGAGCCTCCAGCG AGGCAGTGGCTGGGCTTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 297} {0: 1, 1: 0, 2: 5, 3: 58, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!