ID: 900174729_900174740

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 900174729 900174740
Species Human (GRCh38) Human (GRCh38)
Location 1:1286652-1286674 1:1286691-1286713
Sequence CCCACTGGGCGTCCCGAGTAGGG GACAGCACACACTGGGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74} {0: 1, 1: 1, 2: 0, 3: 16, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!