ID: 900177024_900177036

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 900177024 900177036
Species Human (GRCh38) Human (GRCh38)
Location 1:1295460-1295482 1:1295510-1295532
Sequence CCCTGCGGCCCCTGCGTCGAAGT GACAGAAGAGGGAGTCTCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 29} {0: 1, 1: 0, 2: 0, 3: 12, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!