|
Left Crispr |
Right Crispr |
| Crispr ID |
900177492 |
900177498 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:1297359-1297381
|
1:1297375-1297397
|
| Sequence |
CCATCCCCGGTGGCACGTGTGTG |
GTGTGTGTGTGCACAGGCACGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 6, 2: 1, 3: 11, 4: 129} |
{0: 2, 1: 8, 2: 31, 3: 179, 4: 946} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|