ID: 900191245_900191258

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 900191245 900191258
Species Human (GRCh38) Human (GRCh38)
Location 1:1353216-1353238 1:1353258-1353280
Sequence CCTGGAGGAGTGGGACTCCTGCC TGGGGCTGCCAGGTTCTGATGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 34, 4: 345} {0: 1, 1: 0, 2: 2, 3: 16, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!