ID: 900191247_900191258

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 900191247 900191258
Species Human (GRCh38) Human (GRCh38)
Location 1:1353233-1353255 1:1353258-1353280
Sequence CCTGCCCTGAGGCTGACCCCAGT TGGGGCTGCCAGGTTCTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 321} {0: 1, 1: 0, 2: 2, 3: 16, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!