ID: 900191880_900191885

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 900191880 900191885
Species Human (GRCh38) Human (GRCh38)
Location 1:1355546-1355568 1:1355565-1355587
Sequence CCGAGTACAAGTCCAGCAGGCGC GCGCCGCGCGGGGCCACCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94} {0: 1, 1: 0, 2: 8, 3: 35, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!