ID: 900191890_900191903

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 900191890 900191903
Species Human (GRCh38) Human (GRCh38)
Location 1:1355578-1355600 1:1355619-1355641
Sequence CCACCCCCGGGGCCGCGCAGGTC GCGGTCGTGCAGCCGGTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 218} {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!