ID: 900192660_900192664

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 900192660 900192664
Species Human (GRCh38) Human (GRCh38)
Location 1:1358078-1358100 1:1358101-1358123
Sequence CCCAGGCCTGGGAGCGGGGGCTG GAACAGACCCCACAGTTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 586} {0: 1, 1: 0, 2: 3, 3: 10, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!