ID: 900196945_900196950

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 900196945 900196950
Species Human (GRCh38) Human (GRCh38)
Location 1:1381279-1381301 1:1381301-1381323
Sequence CCACCTTGTGGCTGGCGACCCTC CACTTTCCGGATGCTGAACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!