ID: 900197907_900197910

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 900197907 900197910
Species Human (GRCh38) Human (GRCh38)
Location 1:1386435-1386457 1:1386469-1386491
Sequence CCTGGACACTTTCACAAGCACAC CTACCACGTCCATAACGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 176} {0: 1, 1: 0, 2: 0, 3: 3, 4: 11}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!