|
Left Crispr |
Right Crispr |
| Crispr ID |
900201290 |
900201298 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:1407780-1407802
|
1:1407809-1407831
|
| Sequence |
CCCGACCTCGGCTCGCCGCGGCC |
TTCCTAGTAGCTGGGACGTCAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 1, 1: 4, 2: 262, 3: 9003, 4: 136039} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|