ID: 900203305_900203321

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 900203305 900203321
Species Human (GRCh38) Human (GRCh38)
Location 1:1420724-1420746 1:1420769-1420791
Sequence CCCACCCAGTGCTGGGACCCCCA ACCCCTTCACCCCCCAGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 39, 4: 296} {0: 1, 1: 0, 2: 1, 3: 18, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!