ID: 900207198_900207212

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 900207198 900207212
Species Human (GRCh38) Human (GRCh38)
Location 1:1436599-1436621 1:1436647-1436669
Sequence CCTGGGGGCCTAGGCCAGGACTC GTGAGGAATGGGAAGGTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 256} {0: 1, 1: 0, 2: 5, 3: 68, 4: 670}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!