ID: 900207206_900207212

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 900207206 900207212
Species Human (GRCh38) Human (GRCh38)
Location 1:1436631-1436653 1:1436647-1436669
Sequence CCTGCTTGCAGGGTCTGTGAGGA GTGAGGAATGGGAAGGTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 182} {0: 1, 1: 0, 2: 5, 3: 68, 4: 670}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!