ID: 900208122_900208133

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 900208122 900208133
Species Human (GRCh38) Human (GRCh38)
Location 1:1440131-1440153 1:1440169-1440191
Sequence CCAAGTGGCAAGGGCTGGCCTGG TCCTGGACGTTGATAGGAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 335} {0: 1, 1: 0, 2: 0, 3: 10, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!