ID: 900210235_900210242

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 900210235 900210242
Species Human (GRCh38) Human (GRCh38)
Location 1:1451952-1451974 1:1451993-1452015
Sequence CCCTGCGGTCCTGGGGCGGACGC GAGCATTTTTCTGGTTTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 73} {0: 2, 1: 0, 2: 0, 3: 25, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!