ID: 900211768_900211776

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 900211768 900211776
Species Human (GRCh38) Human (GRCh38)
Location 1:1459710-1459732 1:1459731-1459753
Sequence CCCTCCAGGCTTGGGGCCCACCC CCGACTTTGTGTGGCCTCTGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 29, 4: 314} {0: 2, 1: 0, 2: 0, 3: 11, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!