ID: 900211768_900211781

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 900211768 900211781
Species Human (GRCh38) Human (GRCh38)
Location 1:1459710-1459732 1:1459758-1459780
Sequence CCCTCCAGGCTTGGGGCCCACCC CCGCCCAGATGTCCCCCATAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 29, 4: 314} {0: 1, 1: 1, 2: 0, 3: 5, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!