ID: 900218933_900218938

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 900218933 900218938
Species Human (GRCh38) Human (GRCh38)
Location 1:1496691-1496713 1:1496719-1496741
Sequence CCACACTCGCTGCCTGAATTCTG AGAGCGTGGTACCCACTGCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 15, 4: 166} {0: 2, 1: 0, 2: 0, 3: 7, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!