ID: 900225688_900225695

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 900225688 900225695
Species Human (GRCh38) Human (GRCh38)
Location 1:1532732-1532754 1:1532778-1532800
Sequence CCTCTCTTGGGTGCGCTCAAGAC GGGCCCCGGACCCACAGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 0, 3: 2, 4: 46} {0: 1, 1: 6, 2: 4, 3: 14, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!