ID: 900228009_900228016

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 900228009 900228016
Species Human (GRCh38) Human (GRCh38)
Location 1:1541623-1541645 1:1541645-1541667
Sequence CCACCTCCTCAGGGGCGAGGGTC CGGGCCAGGAATTCAGGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 174} {0: 1, 1: 0, 2: 3, 3: 41, 4: 470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!