ID: 900241233_900241243

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 900241233 900241243
Species Human (GRCh38) Human (GRCh38)
Location 1:1618533-1618555 1:1618555-1618577
Sequence CCACATCACCTGCTCCCAGGCCT TGCCCAGGGGATGGGTCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 57, 4: 581} {0: 1, 1: 0, 2: 1, 3: 35, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!