ID: 900252043_900252046

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 900252043 900252046
Species Human (GRCh38) Human (GRCh38)
Location 1:1675989-1676011 1:1676030-1676052
Sequence CCCCGCTCTAGTAACGAGAGGGA AGAGACACTCAACCAAAACCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 21} {0: 2, 1: 0, 2: 0, 3: 24, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!