ID: 900265328_900265341

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 900265328 900265341
Species Human (GRCh38) Human (GRCh38)
Location 1:1754317-1754339 1:1754369-1754391
Sequence CCAGGTAGACATCCACATTGGAC CACCTCATTCAGGACCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 71} {0: 1, 1: 0, 2: 3, 3: 17, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!