ID: 900265708_900265716

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 900265708 900265716
Species Human (GRCh38) Human (GRCh38)
Location 1:1756032-1756054 1:1756064-1756086
Sequence CCCAGGCGGGCGCTGGCCACCCC CACTGTGTCCACACTGCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 180} {0: 1, 1: 0, 2: 2, 3: 44, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!