ID: 900288877_900288890

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 900288877 900288890
Species Human (GRCh38) Human (GRCh38)
Location 1:1915462-1915484 1:1915499-1915521
Sequence CCCCGCACTTAGCCTTCGGTGCC GGGGAAGCCCAGGCCAAAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 41} {0: 1, 1: 0, 2: 5, 3: 36, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!