ID: 900291243_900291247

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 900291243 900291247
Species Human (GRCh38) Human (GRCh38)
Location 1:1924404-1924426 1:1924436-1924458
Sequence CCTCTGGGAGGGCGAGCTGAGGA GCTGCTGCTGGCCCCGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 245} {0: 1, 1: 1, 2: 16, 3: 104, 4: 703}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!