ID: 900298383_900298392

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 900298383 900298392
Species Human (GRCh38) Human (GRCh38)
Location 1:1964360-1964382 1:1964387-1964409
Sequence CCACGGCACCCCCATTGCTCAGA CGTCCAGCCCTCCATGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 152} {0: 1, 1: 0, 2: 1, 3: 18, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!