ID: 900298699_900298710

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 900298699 900298710
Species Human (GRCh38) Human (GRCh38)
Location 1:1965778-1965800 1:1965825-1965847
Sequence CCCCAGAACCAGCAGAACCAGGT GGCCAATGCTTACAGAAACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 251} {0: 1, 1: 0, 2: 1, 3: 8, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!