ID: 900310261_900310282

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 900310261 900310282
Species Human (GRCh38) Human (GRCh38)
Location 1:2030054-2030076 1:2030099-2030121
Sequence CCGCCGGCAGCGCCGCGTCCCGG GTCGGTGGGGGTGGAGACAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 247} {0: 1, 1: 0, 2: 4, 3: 52, 4: 645}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!