ID: 900310269_900310287

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 900310269 900310287
Species Human (GRCh38) Human (GRCh38)
Location 1:2030072-2030094 1:2030117-2030139
Sequence CCCGGGGAACCTGATGGGCTCCT AGGGGAGACGAAGAAGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 207} {0: 1, 1: 2, 2: 24, 3: 271, 4: 2464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!