ID: 900310272_900310283

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 900310272 900310283
Species Human (GRCh38) Human (GRCh38)
Location 1:2030081-2030103 1:2030111-2030133
Sequence CCTGATGGGCTCCTACAGGTCGG GGAGACAGGGGAGACGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 51} {0: 1, 1: 0, 2: 8, 3: 89, 4: 922}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!