ID: 900310272_900310286

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 900310272 900310286
Species Human (GRCh38) Human (GRCh38)
Location 1:2030081-2030103 1:2030116-2030138
Sequence CCTGATGGGCTCCTACAGGTCGG CAGGGGAGACGAAGAAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 51} {0: 1, 1: 0, 2: 4, 3: 60, 4: 850}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!