ID: 900310279_900310293

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 900310279 900310293
Species Human (GRCh38) Human (GRCh38)
Location 1:2030092-2030114 1:2030141-2030163
Sequence CCTACAGGTCGGTGGGGGTGGAG AGCCCGCTCAGGAGGCCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 177} {0: 1, 1: 0, 2: 1, 3: 18, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!