ID: 900310874_900310899

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 900310874 900310899
Species Human (GRCh38) Human (GRCh38)
Location 1:2032596-2032618 1:2032647-2032669
Sequence CCCAAGGGCGGGCCTTCCACCCA CCTGGGCCTTTGGGGGAAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 58, 4: 624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!