ID: 900317700_900317708

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 900317700 900317708
Species Human (GRCh38) Human (GRCh38)
Location 1:2067622-2067644 1:2067651-2067673
Sequence CCATGAGGGTGGTGGCACGGGGG TGAGGGGCCGCAGGTGCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 222} {0: 1, 1: 0, 2: 3, 3: 25, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!