ID: 900330610_900330622

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 900330610 900330622
Species Human (GRCh38) Human (GRCh38)
Location 1:2132774-2132796 1:2132807-2132829
Sequence CCACGTTTCCACCCTTAGTCTCT GTGTGTGTATGGTGGGAAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 242} {0: 1, 1: 0, 2: 12, 3: 111, 4: 818}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!