ID: 900330615_900330622

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 900330615 900330622
Species Human (GRCh38) Human (GRCh38)
Location 1:2132785-2132807 1:2132807-2132829
Sequence CCCTTAGTCTCTGAGGGGCCTAG GTGTGTGTATGGTGGGAAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 87} {0: 1, 1: 0, 2: 12, 3: 111, 4: 818}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!