ID: 900334450_900334457

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 900334450 900334457
Species Human (GRCh38) Human (GRCh38)
Location 1:2154708-2154730 1:2154747-2154769
Sequence CCCCGAAGACAAGGGGTTGACCT TTCGTCCAGCTCTACTTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 52} {0: 1, 1: 0, 2: 2, 3: 11, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!