ID: 900337806_900337814

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 900337806 900337814
Species Human (GRCh38) Human (GRCh38)
Location 1:2173360-2173382 1:2173401-2173423
Sequence CCTCAGCAGGGACCAGGGGGACT GCTGCTGTCCTTGGGCAAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 214} {0: 1, 1: 0, 2: 2, 3: 14, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!