ID: 900337811_900337814

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 900337811 900337814
Species Human (GRCh38) Human (GRCh38)
Location 1:2173384-2173406 1:2173401-2173423
Sequence CCGGGGACGCAGAGACAGCTGCT GCTGCTGTCCTTGGGCAAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 271} {0: 1, 1: 0, 2: 2, 3: 14, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!