ID: 900339974_900339986

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 900339974 900339986
Species Human (GRCh38) Human (GRCh38)
Location 1:2183698-2183720 1:2183737-2183759
Sequence CCAAACACTGCATTCCCCGGAGG CCACGTGTCCACATGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 102} {0: 1, 1: 0, 2: 2, 3: 57, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!