ID: 900339982_900339986

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 900339982 900339986
Species Human (GRCh38) Human (GRCh38)
Location 1:2183714-2183736 1:2183737-2183759
Sequence CCGGAGGAGAGAGGGGAGGAAGG CCACGTGTCCACATGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 114, 4: 879} {0: 1, 1: 0, 2: 2, 3: 57, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!