ID: 900343781_900343794

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 900343781 900343794
Species Human (GRCh38) Human (GRCh38)
Location 1:2201214-2201236 1:2201259-2201281
Sequence CCCTCGCTGCCCCTGTGTTGGAA GGCCCTGCGCATCCTCCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112} {0: 1, 1: 1, 2: 2, 3: 17, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!