|
Left Crispr |
Right Crispr |
| Crispr ID |
900356839 |
900356847 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:2269031-2269053
|
1:2269084-2269106
|
| Sequence |
CCTTGTTGGTTCAAGTGATCCTC |
CAGGCACACACCACTACATCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 231, 3: 3972, 4: 42868} |
{0: 4, 1: 174, 2: 2008, 3: 8984, 4: 29747} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|