ID: 900364714_900364724

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 900364714 900364724
Species Human (GRCh38) Human (GRCh38)
Location 1:2306386-2306408 1:2306435-2306457
Sequence CCGACGGGCACAGGGTGGGTGGT GTGTCCTAGCAGGTGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135} {0: 1, 1: 0, 2: 1, 3: 34, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!