ID: 900372231_900372242

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 900372231 900372242
Species Human (GRCh38) Human (GRCh38)
Location 1:2337145-2337167 1:2337169-2337191
Sequence CCCATCAGCAGCCCCCGTCAGCC AGGCACTCGCTTCCAGGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 169} {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!