ID: 900376067_900376071

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 900376067 900376071
Species Human (GRCh38) Human (GRCh38)
Location 1:2355447-2355469 1:2355472-2355494
Sequence CCTAGAAGAGTGAGCTCCCTGCA CACAGACCCCCGAGGCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 187} {0: 1, 1: 0, 2: 1, 3: 16, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!