ID: 900379518_900379530

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 900379518 900379530
Species Human (GRCh38) Human (GRCh38)
Location 1:2376998-2377020 1:2377040-2377062
Sequence CCCGGGCCTCAGGGAGCACCCAG CCAGCGTGGAGAGTTACGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 92, 4: 649} {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!